credits definitionApplet whenNovember 2006 group membersPilar Pèrez
Valeria Fagiolani de la Madrid

 productionProcessing coding OPEN APPLET
the assignment The assignemnt was to create our own decoding mechanism for genetic code. Feeding it with actual code-sequences we should be able to go on a search for hidden messages in the code ... the idea Transforming text-information into pixel-information and looking for text-information in given image-output.

We mapped each of the letters of the 4-Letter-Alphabet ( G . A . T . C ) a genetic sequence consists of to either a black or a white value. Then we filled little pixelmaps of sizes between 5-times-5 to 10-times-10 one after each other and displayed them in a lattice. The pixelmaps have perfect icon-size and make it possible to search for either simple symbols or recognizable letters. Different pixelmap-sizes produce different results of the same code-sequences.

The code we used for this applet comes from the first chromosome of a mouse. some results letters, symbols, signs, or forms?





 the DNA-code This txt-file provides the input-data for the applet.

An excerpt can be seen here:
gaattctctgtttaactctgaaaaggtcaactagtttatataagcaagaaggataagagt ctaaattaacatactacttgccagagtcttgacacattttgtttttctttccctccttca ataaatttatttaaaattttctgtataatatgtgctctgttaagttcttgagctgcatgg agacagaggccaactagctttccactccgagaatctacattctagtccaaggcctttcct aatgtgaggtgtgaggtatcccattgtatctttaggacccacactaaccatcttaatttt atttcatcagcattttaagtgtgagaacattcaagctgcattggcaaagagttcaagaat taaataggcatgatttttgtgagccaagatatagagagactggaggcagttttggtcttt ctcgatgacacagttttgtgaaattccacagtatcttttactgtgcataactcaatgtaa tgtgaaactctcctccaggtatggtccagatatgctcatgcttatccagggctgcagtac tttcttgtggttggttctgatgcccttcatcaatgctctagaaaaagcagcacaccactt tttattctttcctgttttccccctagattcaaatcaaatgtctgttccatggtcgtccta gcaccttgcgtagcattctcttcctccttttctctccttcctggtaccaagcaggcggaa ctctatggagaggtcacatcagctcaacctgtgttcatgattttgtgatggatatgtgcc tatctgtaaccaaaacagtataattctttctttttcttttcttgttctttctttctttta tgagtttttgagacaggatttctcggtatagccctggctgacctggaactcactctgtag accaggctggccttgaactcagagatctgcctgcctct.........